ID: 1024705963

View in Genome Browser
Species Human (GRCh38)
Location 7:51959810-51959832
Sequence GAGGCAGAATCTGTGCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024705963_1024705969 8 Left 1024705963 7:51959810-51959832 CCAAAGTGCACAGATTCTGCCTC No data
Right 1024705969 7:51959841-51959863 GAGGCTCTTGCCAGAGGTTGGGG No data
1024705963_1024705968 7 Left 1024705963 7:51959810-51959832 CCAAAGTGCACAGATTCTGCCTC No data
Right 1024705968 7:51959840-51959862 CGAGGCTCTTGCCAGAGGTTGGG No data
1024705963_1024705966 2 Left 1024705963 7:51959810-51959832 CCAAAGTGCACAGATTCTGCCTC No data
Right 1024705966 7:51959835-51959857 TGCTGCGAGGCTCTTGCCAGAGG No data
1024705963_1024705970 17 Left 1024705963 7:51959810-51959832 CCAAAGTGCACAGATTCTGCCTC No data
Right 1024705970 7:51959850-51959872 GCCAGAGGTTGGGGCAGAAGTGG No data
1024705963_1024705967 6 Left 1024705963 7:51959810-51959832 CCAAAGTGCACAGATTCTGCCTC No data
Right 1024705967 7:51959839-51959861 GCGAGGCTCTTGCCAGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024705963 Original CRISPR GAGGCAGAATCTGTGCACTT TGG (reversed) Intergenic
No off target data available for this crispr