ID: 1024705964

View in Genome Browser
Species Human (GRCh38)
Location 7:51959822-51959844
Sequence GATTCTGCCTCTATGCTGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024705962_1024705964 -10 Left 1024705962 7:51959809-51959831 CCCAAAGTGCACAGATTCTGCCT No data
Right 1024705964 7:51959822-51959844 GATTCTGCCTCTATGCTGCGAGG No data
1024705956_1024705964 14 Left 1024705956 7:51959785-51959807 CCCCCAGTCACTGCATTCTTCCT No data
Right 1024705964 7:51959822-51959844 GATTCTGCCTCTATGCTGCGAGG No data
1024705957_1024705964 13 Left 1024705957 7:51959786-51959808 CCCCAGTCACTGCATTCTTCCTC No data
Right 1024705964 7:51959822-51959844 GATTCTGCCTCTATGCTGCGAGG No data
1024705958_1024705964 12 Left 1024705958 7:51959787-51959809 CCCAGTCACTGCATTCTTCCTCC No data
Right 1024705964 7:51959822-51959844 GATTCTGCCTCTATGCTGCGAGG No data
1024705960_1024705964 -6 Left 1024705960 7:51959805-51959827 CCTCCCCAAAGTGCACAGATTCT 0: 13
1: 38
2: 125
3: 202
4: 596
Right 1024705964 7:51959822-51959844 GATTCTGCCTCTATGCTGCGAGG No data
1024705959_1024705964 11 Left 1024705959 7:51959788-51959810 CCAGTCACTGCATTCTTCCTCCC No data
Right 1024705964 7:51959822-51959844 GATTCTGCCTCTATGCTGCGAGG No data
1024705961_1024705964 -9 Left 1024705961 7:51959808-51959830 CCCCAAAGTGCACAGATTCTGCC No data
Right 1024705964 7:51959822-51959844 GATTCTGCCTCTATGCTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024705964 Original CRISPR GATTCTGCCTCTATGCTGCG AGG Intergenic
No off target data available for this crispr