ID: 1024705966

View in Genome Browser
Species Human (GRCh38)
Location 7:51959835-51959857
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024705962_1024705966 3 Left 1024705962 7:51959809-51959831 CCCAAAGTGCACAGATTCTGCCT No data
Right 1024705966 7:51959835-51959857 TGCTGCGAGGCTCTTGCCAGAGG No data
1024705958_1024705966 25 Left 1024705958 7:51959787-51959809 CCCAGTCACTGCATTCTTCCTCC No data
Right 1024705966 7:51959835-51959857 TGCTGCGAGGCTCTTGCCAGAGG No data
1024705960_1024705966 7 Left 1024705960 7:51959805-51959827 CCTCCCCAAAGTGCACAGATTCT No data
Right 1024705966 7:51959835-51959857 TGCTGCGAGGCTCTTGCCAGAGG No data
1024705956_1024705966 27 Left 1024705956 7:51959785-51959807 CCCCCAGTCACTGCATTCTTCCT No data
Right 1024705966 7:51959835-51959857 TGCTGCGAGGCTCTTGCCAGAGG No data
1024705963_1024705966 2 Left 1024705963 7:51959810-51959832 CCAAAGTGCACAGATTCTGCCTC No data
Right 1024705966 7:51959835-51959857 TGCTGCGAGGCTCTTGCCAGAGG No data
1024705961_1024705966 4 Left 1024705961 7:51959808-51959830 CCCCAAAGTGCACAGATTCTGCC No data
Right 1024705966 7:51959835-51959857 TGCTGCGAGGCTCTTGCCAGAGG No data
1024705957_1024705966 26 Left 1024705957 7:51959786-51959808 CCCCAGTCACTGCATTCTTCCTC No data
Right 1024705966 7:51959835-51959857 TGCTGCGAGGCTCTTGCCAGAGG No data
1024705959_1024705966 24 Left 1024705959 7:51959788-51959810 CCAGTCACTGCATTCTTCCTCCC No data
Right 1024705966 7:51959835-51959857 TGCTGCGAGGCTCTTGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024705966 Original CRISPR TGCTGCGAGGCTCTTGCCAG AGG Intergenic