ID: 1024705968

View in Genome Browser
Species Human (GRCh38)
Location 7:51959840-51959862
Sequence CGAGGCTCTTGCCAGAGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024705963_1024705968 7 Left 1024705963 7:51959810-51959832 CCAAAGTGCACAGATTCTGCCTC No data
Right 1024705968 7:51959840-51959862 CGAGGCTCTTGCCAGAGGTTGGG No data
1024705961_1024705968 9 Left 1024705961 7:51959808-51959830 CCCCAAAGTGCACAGATTCTGCC No data
Right 1024705968 7:51959840-51959862 CGAGGCTCTTGCCAGAGGTTGGG No data
1024705958_1024705968 30 Left 1024705958 7:51959787-51959809 CCCAGTCACTGCATTCTTCCTCC No data
Right 1024705968 7:51959840-51959862 CGAGGCTCTTGCCAGAGGTTGGG No data
1024705962_1024705968 8 Left 1024705962 7:51959809-51959831 CCCAAAGTGCACAGATTCTGCCT No data
Right 1024705968 7:51959840-51959862 CGAGGCTCTTGCCAGAGGTTGGG No data
1024705960_1024705968 12 Left 1024705960 7:51959805-51959827 CCTCCCCAAAGTGCACAGATTCT No data
Right 1024705968 7:51959840-51959862 CGAGGCTCTTGCCAGAGGTTGGG No data
1024705959_1024705968 29 Left 1024705959 7:51959788-51959810 CCAGTCACTGCATTCTTCCTCCC No data
Right 1024705968 7:51959840-51959862 CGAGGCTCTTGCCAGAGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024705968 Original CRISPR CGAGGCTCTTGCCAGAGGTT GGG Intergenic