ID: 1024706524

View in Genome Browser
Species Human (GRCh38)
Location 7:51967176-51967198
Sequence GTTGGCAGCTAACTCTCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024706524_1024706530 11 Left 1024706524 7:51967176-51967198 CCATGAGAGAGTTAGCTGCCAAC No data
Right 1024706530 7:51967210-51967232 AGAGCAGCACGCAGTAGGACAGG No data
1024706524_1024706529 6 Left 1024706524 7:51967176-51967198 CCATGAGAGAGTTAGCTGCCAAC No data
Right 1024706529 7:51967205-51967227 TGGGTAGAGCAGCACGCAGTAGG No data
1024706524_1024706532 19 Left 1024706524 7:51967176-51967198 CCATGAGAGAGTTAGCTGCCAAC No data
Right 1024706532 7:51967218-51967240 ACGCAGTAGGACAGGAAGGACGG No data
1024706524_1024706533 20 Left 1024706524 7:51967176-51967198 CCATGAGAGAGTTAGCTGCCAAC No data
Right 1024706533 7:51967219-51967241 CGCAGTAGGACAGGAAGGACGGG No data
1024706524_1024706534 21 Left 1024706524 7:51967176-51967198 CCATGAGAGAGTTAGCTGCCAAC No data
Right 1024706534 7:51967220-51967242 GCAGTAGGACAGGAAGGACGGGG No data
1024706524_1024706531 15 Left 1024706524 7:51967176-51967198 CCATGAGAGAGTTAGCTGCCAAC No data
Right 1024706531 7:51967214-51967236 CAGCACGCAGTAGGACAGGAAGG No data
1024706524_1024706535 22 Left 1024706524 7:51967176-51967198 CCATGAGAGAGTTAGCTGCCAAC No data
Right 1024706535 7:51967221-51967243 CAGTAGGACAGGAAGGACGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024706524 Original CRISPR GTTGGCAGCTAACTCTCTCA TGG (reversed) Intergenic
No off target data available for this crispr