ID: 1024706528

View in Genome Browser
Species Human (GRCh38)
Location 7:51967194-51967216
Sequence CTGCTCTACCCACCATGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024706528_1024706533 2 Left 1024706528 7:51967194-51967216 CCAACGCATGGTGGGTAGAGCAG No data
Right 1024706533 7:51967219-51967241 CGCAGTAGGACAGGAAGGACGGG No data
1024706528_1024706536 21 Left 1024706528 7:51967194-51967216 CCAACGCATGGTGGGTAGAGCAG No data
Right 1024706536 7:51967238-51967260 CGGGGGTGCAGTCATAGAAGTGG No data
1024706528_1024706530 -7 Left 1024706528 7:51967194-51967216 CCAACGCATGGTGGGTAGAGCAG No data
Right 1024706530 7:51967210-51967232 AGAGCAGCACGCAGTAGGACAGG No data
1024706528_1024706534 3 Left 1024706528 7:51967194-51967216 CCAACGCATGGTGGGTAGAGCAG No data
Right 1024706534 7:51967220-51967242 GCAGTAGGACAGGAAGGACGGGG No data
1024706528_1024706532 1 Left 1024706528 7:51967194-51967216 CCAACGCATGGTGGGTAGAGCAG No data
Right 1024706532 7:51967218-51967240 ACGCAGTAGGACAGGAAGGACGG No data
1024706528_1024706531 -3 Left 1024706528 7:51967194-51967216 CCAACGCATGGTGGGTAGAGCAG No data
Right 1024706531 7:51967214-51967236 CAGCACGCAGTAGGACAGGAAGG No data
1024706528_1024706535 4 Left 1024706528 7:51967194-51967216 CCAACGCATGGTGGGTAGAGCAG No data
Right 1024706535 7:51967221-51967243 CAGTAGGACAGGAAGGACGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024706528 Original CRISPR CTGCTCTACCCACCATGCGT TGG (reversed) Intergenic
No off target data available for this crispr