ID: 1024706535

View in Genome Browser
Species Human (GRCh38)
Location 7:51967221-51967243
Sequence CAGTAGGACAGGAAGGACGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024706524_1024706535 22 Left 1024706524 7:51967176-51967198 CCATGAGAGAGTTAGCTGCCAAC No data
Right 1024706535 7:51967221-51967243 CAGTAGGACAGGAAGGACGGGGG No data
1024706528_1024706535 4 Left 1024706528 7:51967194-51967216 CCAACGCATGGTGGGTAGAGCAG No data
Right 1024706535 7:51967221-51967243 CAGTAGGACAGGAAGGACGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024706535 Original CRISPR CAGTAGGACAGGAAGGACGG GGG Intergenic
No off target data available for this crispr