ID: 1024709385

View in Genome Browser
Species Human (GRCh38)
Location 7:51998333-51998355
Sequence CTGCAGGTTGATCAGGCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024709385_1024709389 -8 Left 1024709385 7:51998333-51998355 CCATATGCCTGATCAACCTGCAG No data
Right 1024709389 7:51998348-51998370 ACCTGCAGCCTTAAGTGAAGGGG No data
1024709385_1024709391 -5 Left 1024709385 7:51998333-51998355 CCATATGCCTGATCAACCTGCAG No data
Right 1024709391 7:51998351-51998373 TGCAGCCTTAAGTGAAGGGGTGG No data
1024709385_1024709387 -10 Left 1024709385 7:51998333-51998355 CCATATGCCTGATCAACCTGCAG No data
Right 1024709387 7:51998346-51998368 CAACCTGCAGCCTTAAGTGAAGG No data
1024709385_1024709392 -4 Left 1024709385 7:51998333-51998355 CCATATGCCTGATCAACCTGCAG No data
Right 1024709392 7:51998352-51998374 GCAGCCTTAAGTGAAGGGGTGGG No data
1024709385_1024709388 -9 Left 1024709385 7:51998333-51998355 CCATATGCCTGATCAACCTGCAG No data
Right 1024709388 7:51998347-51998369 AACCTGCAGCCTTAAGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024709385 Original CRISPR CTGCAGGTTGATCAGGCATA TGG (reversed) Intergenic