ID: 1024710442

View in Genome Browser
Species Human (GRCh38)
Location 7:52009423-52009445
Sequence CTGCTTGCCAAGTAGAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024710436_1024710442 18 Left 1024710436 7:52009382-52009404 CCAGCTGTTTCTTCCTGGCACTC No data
Right 1024710442 7:52009423-52009445 CTGCTTGCCAAGTAGAAAAAGGG No data
1024710438_1024710442 5 Left 1024710438 7:52009395-52009417 CCTGGCACTCATAGAAGGTTCCA No data
Right 1024710442 7:52009423-52009445 CTGCTTGCCAAGTAGAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024710442 Original CRISPR CTGCTTGCCAAGTAGAAAAA GGG Intergenic
No off target data available for this crispr