ID: 1024719855

View in Genome Browser
Species Human (GRCh38)
Location 7:52123656-52123678
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024719853_1024719855 4 Left 1024719853 7:52123629-52123651 CCAGGGCTAATCTCTTCATTAGA No data
Right 1024719855 7:52123656-52123678 ATGTGCTTGTATTAGTTTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024719855 Original CRISPR ATGTGCTTGTATTAGTTTGG CGG Intergenic
No off target data available for this crispr