ID: 1024738228

View in Genome Browser
Species Human (GRCh38)
Location 7:52328500-52328522
Sequence CGCCTACCATTGCTGAGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024738228_1024738238 19 Left 1024738228 7:52328500-52328522 CCAAGCCTCAGCAATGGTAGGCG No data
Right 1024738238 7:52328542-52328564 GCCTCCTTGCAGTTTGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024738228 Original CRISPR CGCCTACCATTGCTGAGGCT TGG (reversed) Intergenic
No off target data available for this crispr