ID: 1024738238

View in Genome Browser
Species Human (GRCh38)
Location 7:52328542-52328564
Sequence GCCTCCTTGCAGTTTGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024738231_1024738238 -5 Left 1024738231 7:52328524-52328546 CCCTCCCCCAGCCTCACTGCCTC No data
Right 1024738238 7:52328542-52328564 GCCTCCTTGCAGTTTGATCTTGG No data
1024738234_1024738238 -10 Left 1024738234 7:52328529-52328551 CCCCAGCCTCACTGCCTCCTTGC No data
Right 1024738238 7:52328542-52328564 GCCTCCTTGCAGTTTGATCTTGG No data
1024738230_1024738238 -4 Left 1024738230 7:52328523-52328545 CCCCTCCCCCAGCCTCACTGCCT No data
Right 1024738238 7:52328542-52328564 GCCTCCTTGCAGTTTGATCTTGG No data
1024738226_1024738238 24 Left 1024738226 7:52328495-52328517 CCTAGCCAAGCCTCAGCAATGGT No data
Right 1024738238 7:52328542-52328564 GCCTCCTTGCAGTTTGATCTTGG No data
1024738229_1024738238 14 Left 1024738229 7:52328505-52328527 CCTCAGCAATGGTAGGCGCCCCT No data
Right 1024738238 7:52328542-52328564 GCCTCCTTGCAGTTTGATCTTGG No data
1024738228_1024738238 19 Left 1024738228 7:52328500-52328522 CCAAGCCTCAGCAATGGTAGGCG No data
Right 1024738238 7:52328542-52328564 GCCTCCTTGCAGTTTGATCTTGG No data
1024738232_1024738238 -6 Left 1024738232 7:52328525-52328547 CCTCCCCCAGCCTCACTGCCTCC No data
Right 1024738238 7:52328542-52328564 GCCTCCTTGCAGTTTGATCTTGG No data
1024738233_1024738238 -9 Left 1024738233 7:52328528-52328550 CCCCCAGCCTCACTGCCTCCTTG No data
Right 1024738238 7:52328542-52328564 GCCTCCTTGCAGTTTGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024738238 Original CRISPR GCCTCCTTGCAGTTTGATCT TGG Intergenic
No off target data available for this crispr