ID: 1024745644

View in Genome Browser
Species Human (GRCh38)
Location 7:52402932-52402954
Sequence ACTTGGACATTAAGCAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024745641_1024745644 30 Left 1024745641 7:52402879-52402901 CCTGAAATGACACAATAAGTCTG No data
Right 1024745644 7:52402932-52402954 ACTTGGACATTAAGCAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024745644 Original CRISPR ACTTGGACATTAAGCAAAGA AGG Intergenic
No off target data available for this crispr