ID: 1024747670

View in Genome Browser
Species Human (GRCh38)
Location 7:52427160-52427182
Sequence GGTGGGTTAATGCAAATTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024747670_1024747676 5 Left 1024747670 7:52427160-52427182 CCCTCAATTTGCATTAACCCACC No data
Right 1024747676 7:52427188-52427210 ATTTGCATGTAATTGTAAGTCGG No data
1024747670_1024747678 17 Left 1024747670 7:52427160-52427182 CCCTCAATTTGCATTAACCCACC No data
Right 1024747678 7:52427200-52427222 TTGTAAGTCGGTATAAAAGTGGG No data
1024747670_1024747677 16 Left 1024747670 7:52427160-52427182 CCCTCAATTTGCATTAACCCACC No data
Right 1024747677 7:52427199-52427221 ATTGTAAGTCGGTATAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024747670 Original CRISPR GGTGGGTTAATGCAAATTGA GGG (reversed) Intergenic
No off target data available for this crispr