ID: 1024747676

View in Genome Browser
Species Human (GRCh38)
Location 7:52427188-52427210
Sequence ATTTGCATGTAATTGTAAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024747671_1024747676 4 Left 1024747671 7:52427161-52427183 CCTCAATTTGCATTAACCCACCC No data
Right 1024747676 7:52427188-52427210 ATTTGCATGTAATTGTAAGTCGG No data
1024747669_1024747676 6 Left 1024747669 7:52427159-52427181 CCCCTCAATTTGCATTAACCCAC No data
Right 1024747676 7:52427188-52427210 ATTTGCATGTAATTGTAAGTCGG No data
1024747667_1024747676 30 Left 1024747667 7:52427135-52427157 CCTAGAAAGTTCTGAATAATCCA No data
Right 1024747676 7:52427188-52427210 ATTTGCATGTAATTGTAAGTCGG No data
1024747670_1024747676 5 Left 1024747670 7:52427160-52427182 CCCTCAATTTGCATTAACCCACC No data
Right 1024747676 7:52427188-52427210 ATTTGCATGTAATTGTAAGTCGG No data
1024747668_1024747676 10 Left 1024747668 7:52427155-52427177 CCAACCCCTCAATTTGCATTAAC No data
Right 1024747676 7:52427188-52427210 ATTTGCATGTAATTGTAAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024747676 Original CRISPR ATTTGCATGTAATTGTAAGT CGG Intergenic
No off target data available for this crispr