ID: 1024747677

View in Genome Browser
Species Human (GRCh38)
Location 7:52427199-52427221
Sequence ATTGTAAGTCGGTATAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024747673_1024747677 -2 Left 1024747673 7:52427178-52427200 CCACCCTTTAATTTGCATGTAAT No data
Right 1024747677 7:52427199-52427221 ATTGTAAGTCGGTATAAAAGTGG No data
1024747675_1024747677 -6 Left 1024747675 7:52427182-52427204 CCTTTAATTTGCATGTAATTGTA No data
Right 1024747677 7:52427199-52427221 ATTGTAAGTCGGTATAAAAGTGG No data
1024747671_1024747677 15 Left 1024747671 7:52427161-52427183 CCTCAATTTGCATTAACCCACCC No data
Right 1024747677 7:52427199-52427221 ATTGTAAGTCGGTATAAAAGTGG No data
1024747669_1024747677 17 Left 1024747669 7:52427159-52427181 CCCCTCAATTTGCATTAACCCAC No data
Right 1024747677 7:52427199-52427221 ATTGTAAGTCGGTATAAAAGTGG No data
1024747668_1024747677 21 Left 1024747668 7:52427155-52427177 CCAACCCCTCAATTTGCATTAAC No data
Right 1024747677 7:52427199-52427221 ATTGTAAGTCGGTATAAAAGTGG No data
1024747670_1024747677 16 Left 1024747670 7:52427160-52427182 CCCTCAATTTGCATTAACCCACC No data
Right 1024747677 7:52427199-52427221 ATTGTAAGTCGGTATAAAAGTGG No data
1024747672_1024747677 -1 Left 1024747672 7:52427177-52427199 CCCACCCTTTAATTTGCATGTAA No data
Right 1024747677 7:52427199-52427221 ATTGTAAGTCGGTATAAAAGTGG No data
1024747674_1024747677 -5 Left 1024747674 7:52427181-52427203 CCCTTTAATTTGCATGTAATTGT No data
Right 1024747677 7:52427199-52427221 ATTGTAAGTCGGTATAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024747677 Original CRISPR ATTGTAAGTCGGTATAAAAG TGG Intergenic
No off target data available for this crispr