ID: 1024747724

View in Genome Browser
Species Human (GRCh38)
Location 7:52427547-52427569
Sequence CAGCCCTGCTTCACAAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024747720_1024747724 27 Left 1024747720 7:52427497-52427519 CCGTGCCTGGCTGAGCACATATG No data
Right 1024747724 7:52427547-52427569 CAGCCCTGCTTCACAAGGAGTGG No data
1024747719_1024747724 30 Left 1024747719 7:52427494-52427516 CCGCCGTGCCTGGCTGAGCACAT No data
Right 1024747724 7:52427547-52427569 CAGCCCTGCTTCACAAGGAGTGG No data
1024747721_1024747724 22 Left 1024747721 7:52427502-52427524 CCTGGCTGAGCACATATGTTAAC No data
Right 1024747724 7:52427547-52427569 CAGCCCTGCTTCACAAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024747724 Original CRISPR CAGCCCTGCTTCACAAGGAG TGG Intergenic
No off target data available for this crispr