ID: 1024752456

View in Genome Browser
Species Human (GRCh38)
Location 7:52483501-52483523
Sequence CAGGGACAACAAAGGCCGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024752451_1024752456 25 Left 1024752451 7:52483453-52483475 CCACTGATGCTAAAGAGTGGCTT No data
Right 1024752456 7:52483501-52483523 CAGGGACAACAAAGGCCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024752456 Original CRISPR CAGGGACAACAAAGGCCGGC AGG Intergenic
No off target data available for this crispr