ID: 1024757298

View in Genome Browser
Species Human (GRCh38)
Location 7:52549952-52549974
Sequence CTGCTGTCCAGGGTCAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024757298_1024757303 -7 Left 1024757298 7:52549952-52549974 CCAGCTTTGACCCTGGACAGCAG No data
Right 1024757303 7:52549968-52549990 ACAGCAGTTACAAGCAAGGGCGG No data
1024757298_1024757306 30 Left 1024757298 7:52549952-52549974 CCAGCTTTGACCCTGGACAGCAG No data
Right 1024757306 7:52550005-52550027 AGAGGAGACAGCAGAGAGCCTGG No data
1024757298_1024757302 -10 Left 1024757298 7:52549952-52549974 CCAGCTTTGACCCTGGACAGCAG No data
Right 1024757302 7:52549965-52549987 TGGACAGCAGTTACAAGCAAGGG No data
1024757298_1024757304 -1 Left 1024757298 7:52549952-52549974 CCAGCTTTGACCCTGGACAGCAG No data
Right 1024757304 7:52549974-52549996 GTTACAAGCAAGGGCGGAGAAGG No data
1024757298_1024757305 12 Left 1024757298 7:52549952-52549974 CCAGCTTTGACCCTGGACAGCAG No data
Right 1024757305 7:52549987-52550009 GCGGAGAAGGTACTCGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024757298 Original CRISPR CTGCTGTCCAGGGTCAAAGC TGG (reversed) Intergenic
No off target data available for this crispr