ID: 1024757833

View in Genome Browser
Species Human (GRCh38)
Location 7:52557199-52557221
Sequence TGAGCTCCTGATTATTGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024757833_1024757840 24 Left 1024757833 7:52557199-52557221 CCCTGTCAATAATCAGGAGCTCA No data
Right 1024757840 7:52557246-52557268 GATGTCAGTAAAAAGAGTGCAGG No data
1024757833_1024757841 25 Left 1024757833 7:52557199-52557221 CCCTGTCAATAATCAGGAGCTCA No data
Right 1024757841 7:52557247-52557269 ATGTCAGTAAAAAGAGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024757833 Original CRISPR TGAGCTCCTGATTATTGACA GGG (reversed) Intergenic
No off target data available for this crispr