ID: 1024757840

View in Genome Browser
Species Human (GRCh38)
Location 7:52557246-52557268
Sequence GATGTCAGTAAAAAGAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024757833_1024757840 24 Left 1024757833 7:52557199-52557221 CCCTGTCAATAATCAGGAGCTCA No data
Right 1024757840 7:52557246-52557268 GATGTCAGTAAAAAGAGTGCAGG No data
1024757834_1024757840 23 Left 1024757834 7:52557200-52557222 CCTGTCAATAATCAGGAGCTCAT No data
Right 1024757840 7:52557246-52557268 GATGTCAGTAAAAAGAGTGCAGG No data
1024757836_1024757840 -10 Left 1024757836 7:52557233-52557255 CCCTCACCCATGAGATGTCAGTA No data
Right 1024757840 7:52557246-52557268 GATGTCAGTAAAAAGAGTGCAGG No data
1024757835_1024757840 -2 Left 1024757835 7:52557225-52557247 CCTCTGTGCCCTCACCCATGAGA No data
Right 1024757840 7:52557246-52557268 GATGTCAGTAAAAAGAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024757840 Original CRISPR GATGTCAGTAAAAAGAGTGC AGG Intergenic
No off target data available for this crispr