ID: 1024758329

View in Genome Browser
Species Human (GRCh38)
Location 7:52563240-52563262
Sequence TTGCATGTTGATAAAGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024758327_1024758329 19 Left 1024758327 7:52563198-52563220 CCTAACATGGCAAAACAGTAACA No data
Right 1024758329 7:52563240-52563262 TTGCATGTTGATAAAGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024758329 Original CRISPR TTGCATGTTGATAAAGTGAA AGG Intergenic
No off target data available for this crispr