ID: 1024761942

View in Genome Browser
Species Human (GRCh38)
Location 7:52609366-52609388
Sequence CAGTGTGCACACCGAGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024761942_1024761945 -10 Left 1024761942 7:52609366-52609388 CCAATGCCTCGGTGTGCACACTG No data
Right 1024761945 7:52609379-52609401 GTGCACACTGGCCTCTGCTCTGG No data
1024761942_1024761947 11 Left 1024761942 7:52609366-52609388 CCAATGCCTCGGTGTGCACACTG No data
Right 1024761947 7:52609400-52609422 GGCTCCCTGCCATGCCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024761942 Original CRISPR CAGTGTGCACACCGAGGCAT TGG (reversed) Intergenic
No off target data available for this crispr