ID: 1024775717

View in Genome Browser
Species Human (GRCh38)
Location 7:52783252-52783274
Sequence GCAATGAAGACAAATGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024775711_1024775717 13 Left 1024775711 7:52783216-52783238 CCTGCTGCTTGTGGCATGAACAT No data
Right 1024775717 7:52783252-52783274 GCAATGAAGACAAATGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024775717 Original CRISPR GCAATGAAGACAAATGTTCC AGG Intergenic
No off target data available for this crispr