ID: 1024777396

View in Genome Browser
Species Human (GRCh38)
Location 7:52803509-52803531
Sequence CTGAGGATAAGGAAAGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024777396_1024777404 5 Left 1024777396 7:52803509-52803531 CCATCCCCTTTCCTTATCCTCAG No data
Right 1024777404 7:52803537-52803559 ACATCATTGTCTGACCCAAAGGG No data
1024777396_1024777407 23 Left 1024777396 7:52803509-52803531 CCATCCCCTTTCCTTATCCTCAG No data
Right 1024777407 7:52803555-52803577 AAGGGCACCCACCGTCAATTTGG No data
1024777396_1024777403 4 Left 1024777396 7:52803509-52803531 CCATCCCCTTTCCTTATCCTCAG No data
Right 1024777403 7:52803536-52803558 CACATCATTGTCTGACCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024777396 Original CRISPR CTGAGGATAAGGAAAGGGGA TGG (reversed) Intergenic
No off target data available for this crispr