ID: 1024777403

View in Genome Browser
Species Human (GRCh38)
Location 7:52803536-52803558
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024777401_1024777403 -7 Left 1024777401 7:52803520-52803542 CCTTATCCTCAGGACACACATCA No data
Right 1024777403 7:52803536-52803558 CACATCATTGTCTGACCCAAAGG No data
1024777399_1024777403 -1 Left 1024777399 7:52803514-52803536 CCCTTTCCTTATCCTCAGGACAC No data
Right 1024777403 7:52803536-52803558 CACATCATTGTCTGACCCAAAGG No data
1024777398_1024777403 0 Left 1024777398 7:52803513-52803535 CCCCTTTCCTTATCCTCAGGACA No data
Right 1024777403 7:52803536-52803558 CACATCATTGTCTGACCCAAAGG No data
1024777396_1024777403 4 Left 1024777396 7:52803509-52803531 CCATCCCCTTTCCTTATCCTCAG No data
Right 1024777403 7:52803536-52803558 CACATCATTGTCTGACCCAAAGG No data
1024777400_1024777403 -2 Left 1024777400 7:52803515-52803537 CCTTTCCTTATCCTCAGGACACA No data
Right 1024777403 7:52803536-52803558 CACATCATTGTCTGACCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024777403 Original CRISPR CACATCATTGTCTGACCCAA AGG Intergenic
No off target data available for this crispr