ID: 1024778348

View in Genome Browser
Species Human (GRCh38)
Location 7:52815993-52816015
Sequence ATAGACAAAACTGCCTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024778344_1024778348 8 Left 1024778344 7:52815962-52815984 CCTAATAGCAGCAATAATTTCCG No data
Right 1024778348 7:52815993-52816015 ATAGACAAAACTGCCTTTGTGGG No data
1024778340_1024778348 24 Left 1024778340 7:52815946-52815968 CCCCCACTCATATGCTCCTAATA No data
Right 1024778348 7:52815993-52816015 ATAGACAAAACTGCCTTTGTGGG No data
1024778342_1024778348 22 Left 1024778342 7:52815948-52815970 CCCACTCATATGCTCCTAATAGC No data
Right 1024778348 7:52815993-52816015 ATAGACAAAACTGCCTTTGTGGG No data
1024778341_1024778348 23 Left 1024778341 7:52815947-52815969 CCCCACTCATATGCTCCTAATAG No data
Right 1024778348 7:52815993-52816015 ATAGACAAAACTGCCTTTGTGGG No data
1024778343_1024778348 21 Left 1024778343 7:52815949-52815971 CCACTCATATGCTCCTAATAGCA No data
Right 1024778348 7:52815993-52816015 ATAGACAAAACTGCCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024778348 Original CRISPR ATAGACAAAACTGCCTTTGT GGG Intergenic
No off target data available for this crispr