ID: 1024778408

View in Genome Browser
Species Human (GRCh38)
Location 7:52816383-52816405
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024778408_1024778411 2 Left 1024778408 7:52816383-52816405 CCTGGTACAGGCTTGCCAACCTC No data
Right 1024778411 7:52816408-52816430 TCCCACAGCACACCCTGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024778408 Original CRISPR GAGGTTGGCAAGCCTGTACC AGG (reversed) Intergenic
No off target data available for this crispr