ID: 1024779924

View in Genome Browser
Species Human (GRCh38)
Location 7:52836129-52836151
Sequence CAGTTAGTATGTGAGGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024779924_1024779930 -7 Left 1024779924 7:52836129-52836151 CCCACATCCTCACATACTAACTG No data
Right 1024779930 7:52836145-52836167 CTAACTGGTTTGAATGCAAGGGG No data
1024779924_1024779928 -9 Left 1024779924 7:52836129-52836151 CCCACATCCTCACATACTAACTG No data
Right 1024779928 7:52836143-52836165 TACTAACTGGTTTGAATGCAAGG No data
1024779924_1024779931 17 Left 1024779924 7:52836129-52836151 CCCACATCCTCACATACTAACTG No data
Right 1024779931 7:52836169-52836191 AAGAGAGAAAATTACATCTGAGG No data
1024779924_1024779929 -8 Left 1024779924 7:52836129-52836151 CCCACATCCTCACATACTAACTG No data
Right 1024779929 7:52836144-52836166 ACTAACTGGTTTGAATGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024779924 Original CRISPR CAGTTAGTATGTGAGGATGT GGG (reversed) Intergenic
No off target data available for this crispr