ID: 1024780633

View in Genome Browser
Species Human (GRCh38)
Location 7:52843893-52843915
Sequence ACACAGATGCAGAAGTTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024780629_1024780633 4 Left 1024780629 7:52843866-52843888 CCCTTAGAGCACCACTGCTCCAC No data
Right 1024780633 7:52843893-52843915 ACACAGATGCAGAAGTTGAAAGG No data
1024780630_1024780633 3 Left 1024780630 7:52843867-52843889 CCTTAGAGCACCACTGCTCCACG No data
Right 1024780633 7:52843893-52843915 ACACAGATGCAGAAGTTGAAAGG No data
1024780628_1024780633 18 Left 1024780628 7:52843852-52843874 CCATGTGGGCAGAGCCCTTAGAG No data
Right 1024780633 7:52843893-52843915 ACACAGATGCAGAAGTTGAAAGG No data
1024780631_1024780633 -7 Left 1024780631 7:52843877-52843899 CCACTGCTCCACGATGACACAGA No data
Right 1024780633 7:52843893-52843915 ACACAGATGCAGAAGTTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024780633 Original CRISPR ACACAGATGCAGAAGTTGAA AGG Intergenic
No off target data available for this crispr