ID: 1024786876

View in Genome Browser
Species Human (GRCh38)
Location 7:52918136-52918158
Sequence GTGTTGTTTATATCTGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024786873_1024786876 7 Left 1024786873 7:52918106-52918128 CCAATATCAGCTGTTTTCAAAGC No data
Right 1024786876 7:52918136-52918158 GTGTTGTTTATATCTGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024786876 Original CRISPR GTGTTGTTTATATCTGACCC AGG Intergenic
No off target data available for this crispr