ID: 1024788637

View in Genome Browser
Species Human (GRCh38)
Location 7:52937012-52937034
Sequence GCGAGGAAGAGTCTGTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024788637_1024788639 -3 Left 1024788637 7:52937012-52937034 CCACATCACAGACTCTTCCTCGC No data
Right 1024788639 7:52937032-52937054 CGCAAGACCCACAGAACATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024788637 Original CRISPR GCGAGGAAGAGTCTGTGATG TGG (reversed) Intergenic
No off target data available for this crispr