ID: 1024791316

View in Genome Browser
Species Human (GRCh38)
Location 7:52967832-52967854
Sequence ATGTGGGGATACAGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024791316_1024791327 -2 Left 1024791316 7:52967832-52967854 CCCCCTTCCCTGTATCCCCACAT No data
Right 1024791327 7:52967853-52967875 ATGGCCTTTCCTCCTTGCACGGG No data
1024791316_1024791334 24 Left 1024791316 7:52967832-52967854 CCCCCTTCCCTGTATCCCCACAT No data
Right 1024791334 7:52967879-52967901 CCCCAGCTTCTGGCTGGATAAGG No data
1024791316_1024791326 -3 Left 1024791316 7:52967832-52967854 CCCCCTTCCCTGTATCCCCACAT No data
Right 1024791326 7:52967852-52967874 CATGGCCTTTCCTCCTTGCACGG No data
1024791316_1024791331 14 Left 1024791316 7:52967832-52967854 CCCCCTTCCCTGTATCCCCACAT No data
Right 1024791331 7:52967869-52967891 GCACGGGTCACCCCAGCTTCTGG No data
1024791316_1024791332 18 Left 1024791316 7:52967832-52967854 CCCCCTTCCCTGTATCCCCACAT No data
Right 1024791332 7:52967873-52967895 GGGTCACCCCAGCTTCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024791316 Original CRISPR ATGTGGGGATACAGGGAAGG GGG (reversed) Intergenic
No off target data available for this crispr