ID: 1024796932

View in Genome Browser
Species Human (GRCh38)
Location 7:53032026-53032048
Sequence GGGCCGTTTTTTAAGCTGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024796924_1024796932 12 Left 1024796924 7:53031991-53032013 CCCTCCGAGCCAGGTGCAGGATA 0: 189
1: 907
2: 1656
3: 1636
4: 1030
Right 1024796932 7:53032026-53032048 GGGCCGTTTTTTAAGCTGGTCGG No data
1024796927_1024796932 3 Left 1024796927 7:53032000-53032022 CCAGGTGCAGGATATAATCTCGT 0: 81
1: 733
2: 1320
3: 1963
4: 1252
Right 1024796932 7:53032026-53032048 GGGCCGTTTTTTAAGCTGGTCGG No data
1024796925_1024796932 11 Left 1024796925 7:53031992-53032014 CCTCCGAGCCAGGTGCAGGATAT 0: 180
1: 910
2: 1674
3: 1676
4: 1028
Right 1024796932 7:53032026-53032048 GGGCCGTTTTTTAAGCTGGTCGG No data
1024796926_1024796932 8 Left 1024796926 7:53031995-53032017 CCGAGCCAGGTGCAGGATATAAT 0: 291
1: 937
2: 1134
3: 965
4: 607
Right 1024796932 7:53032026-53032048 GGGCCGTTTTTTAAGCTGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024796932 Original CRISPR GGGCCGTTTTTTAAGCTGGT CGG Intergenic
No off target data available for this crispr