ID: 1024797555

View in Genome Browser
Species Human (GRCh38)
Location 7:53036581-53036603
Sequence TGGGCTTGTGTCTCCGGAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 7, 3: 26, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024797555_1024797563 23 Left 1024797555 7:53036581-53036603 CCACCTCCGGAGACACAAGCCCA 0: 1
1: 0
2: 7
3: 26
4: 150
Right 1024797563 7:53036627-53036649 CCTTGCTCTACCTCAACGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 69
1024797555_1024797560 21 Left 1024797555 7:53036581-53036603 CCACCTCCGGAGACACAAGCCCA 0: 1
1: 0
2: 7
3: 26
4: 150
Right 1024797560 7:53036625-53036647 ATCCTTGCTCTACCTCAACGTGG 0: 1
1: 0
2: 0
3: 4
4: 90
1024797555_1024797561 22 Left 1024797555 7:53036581-53036603 CCACCTCCGGAGACACAAGCCCA 0: 1
1: 0
2: 7
3: 26
4: 150
Right 1024797561 7:53036626-53036648 TCCTTGCTCTACCTCAACGTGGG 0: 1
1: 0
2: 0
3: 6
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024797555 Original CRISPR TGGGCTTGTGTCTCCGGAGG TGG (reversed) Exonic
900229632 1:1550065-1550087 TGTGCCTCTGCCTCCGGAGGAGG - Intronic
900414192 1:2527632-2527654 TGGGTGTGTGGCTCTGGAGGGGG + Intergenic
900593198 1:3468861-3468883 TGGGCCTGTGTCCCCCCAGGTGG + Exonic
901057863 1:6457168-6457190 TGTGGTTGTGTTTCAGGAGGAGG + Exonic
901402609 1:9025107-9025129 TGGGCTTGGGCCTCGGGAAGTGG + Intronic
901463629 1:9406544-9406566 TGTGTGTGTGTCTCAGGAGGGGG - Intergenic
901947172 1:12713225-12713247 TCTGCTTCTGTCTCAGGAGGAGG - Intergenic
902476488 1:16691288-16691310 TGTGGTTGTGTTTCAGGAGGAGG - Intergenic
903099136 1:21012922-21012944 TGGGAATGTGTGTTCGGAGGCGG - Intronic
903605508 1:24572550-24572572 TGGGCTGGTGTGTCCAGAGCCGG - Intronic
903853315 1:26321042-26321064 TGGGCTTGAGGCATCGGAGGTGG + Intergenic
905303699 1:37003499-37003521 TGAGCTTCTGGATCCGGAGGTGG + Intronic
905893947 1:41533370-41533392 TGGGCTTGTGTCTGTGGTGGTGG - Intronic
906640323 1:47437619-47437641 TGGGCTCGAGTGGCCGGAGGCGG - Exonic
907430746 1:54409900-54409922 TGGGAGTCTGTCACCGGAGGGGG - Intronic
917033530 1:170721417-170721439 AGGGCCTGTGTCTATGGAGGAGG + Intronic
917108195 1:171516882-171516904 TGGGCTTCTGTCTTGGGTGGAGG - Intronic
920970649 1:210741056-210741078 TGAGCATGTGTCTCCCTAGGTGG - Intronic
921808950 1:219489680-219489702 TTGGCTTGGGTCTGCAGAGGGGG - Intergenic
922369679 1:224896757-224896779 TGGACGTGTGTCTACTGAGGAGG - Intronic
922422485 1:225469195-225469217 TGAGCTTGAGTCTCCAGGGGCGG + Intergenic
923735664 1:236604602-236604624 CGGGCTTTCGTCTCGGGAGGCGG - Intergenic
924794919 1:247286201-247286223 TGGGCTTGTGCCTCCGGACTGGG - Intergenic
924854063 1:247857929-247857951 TGGGCTGGTTTCTCCCGATGCGG + Intronic
1072954529 10:99877050-99877072 AGGGCCTGTGTCTCAGGAGCAGG + Exonic
1077037986 11:504433-504455 TGGCCTTGGGTCTGCGGCGGCGG - Intronic
1080437206 11:32256059-32256081 TGGGCTCTTGTCTCCAGTGGGGG - Intergenic
1083610290 11:64001048-64001070 TGGGCTTGTTTATCCGAGGGCGG + Intronic
1083744243 11:64726438-64726460 TGGGCTTGTGCCTCAGGGTGGGG - Intergenic
1083923071 11:65790807-65790829 TGAGCTTGGGTGTCCCGAGGCGG + Intronic
1085372885 11:76027133-76027155 TGGGCTTGCCTCTCCTCAGGGGG - Intronic
1088939643 11:114439966-114439988 TGGGCTTGGGTCACTGGAGTGGG + Intronic
1089749993 11:120644600-120644622 TGGCCTGATGTCTCAGGAGGAGG + Intronic
1091297498 11:134484088-134484110 TGAGGGTGTGTCTCCAGAGGAGG + Intergenic
1092165187 12:6338002-6338024 TGTGCTTGTGTGTGGGGAGGTGG - Intronic
1097709564 12:62903085-62903107 TGTCCATGTGTCTCAGGAGGGGG - Intronic
1097957931 12:65505743-65505765 TGGGCTCGTGGCTCCTGAGCTGG - Intergenic
1099656810 12:85503507-85503529 TGGGCTTCTGTATCAGAAGGAGG - Intergenic
1100982399 12:100172061-100172083 TGGGCTTGCATTTCCTGAGGAGG - Intergenic
1101991958 12:109493339-109493361 AGAGCTTGTGTCTCTGGAGGTGG - Intronic
1103700827 12:122847968-122847990 TGGGGTGGTGTCTCCTGGGGTGG + Intronic
1104910150 12:132236365-132236387 AGGCCTGGTGTCTCTGGAGGGGG + Intronic
1106702910 13:32248943-32248965 TGAGCTGGTGTCTGCAGAGGAGG + Intronic
1113855829 13:113444991-113445013 TGGGCTTGTGACGCCGATGGTGG + Intronic
1113904105 13:113811403-113811425 TGGCCCTGGGTCTCCGGGGGAGG + Intronic
1114526922 14:23372270-23372292 TAGGCTTGTATCCCCGGTGGGGG + Intergenic
1116699646 14:48223282-48223304 TGGGCTTGTGGTTGTGGAGGAGG + Intergenic
1119968130 14:78939554-78939576 TGCCCTTGTGTCTCCCCAGGAGG - Intronic
1123666744 15:22614316-22614338 TGGGCTCGTGTTTCCAGAGGAGG - Intergenic
1123682729 15:22774207-22774229 TGGGCTTCCGTTTCCTGAGGAGG - Intronic
1123762699 15:23444977-23444999 TGGGCTTCCGTTTCCTGAGGAGG - Intronic
1124320585 15:28708889-28708911 TGGGCTCGTGTTTCCAGAGGAGG - Intronic
1124334480 15:28846730-28846752 TGGGCTTCCGTTTCCTGAGGAGG - Intergenic
1124481909 15:30086460-30086482 TGGGCTCGTGTTTCCAGAGGAGG + Intronic
1124488365 15:30138558-30138580 TGGGCTCGTGTTTCCAGAGGAGG + Intronic
1124521683 15:30410741-30410763 TGGGCTCGTGTTTCCAGAGGAGG - Intronic
1124536980 15:30555478-30555500 TGGGCTCGTGTTTCCAGAGGAGG + Intronic
1124543455 15:30607532-30607554 TGGGCTCGTGTTTCCAGAGGAGG + Intronic
1124563409 15:30794983-30795005 TGGTCTTGTGTTTCCAGAGGAGG + Intergenic
1124755162 15:32399762-32399784 TGGGCTCGTGTTTCCAGAGGAGG - Intronic
1124761670 15:32452113-32452135 TGGGCTCGTGTTTCCAGAGGAGG - Intronic
1124776958 15:32596955-32596977 TGGGCTCGTGTTTCCAGAGGAGG + Intronic
1124959868 15:34386247-34386269 TGGGCTCGTGTTTCCAGAGGAGG - Intronic
1124976495 15:34532468-34532490 TGGGCTCGTGTTTCCAGAGGAGG - Intronic
1127773954 15:62251520-62251542 TGGGCTTGTGTTTCCCGAGGAGG - Intergenic
1128115405 15:65102114-65102136 TAGGCTTGTGGCTCCGCAGCGGG + Exonic
1129029475 15:72607954-72607976 TGGGCTTGTGTTTCCAGAGGAGG + Intergenic
1129037413 15:72658997-72659019 TGGGCTTGTGTTTCTGGAGGAGG + Intronic
1129212474 15:74078228-74078250 TGGGCTTGTGTTTCTGGAGGAGG - Intronic
1129397925 15:75262851-75262873 TGGGCTTGTGTTTCTGGAGGAGG + Intronic
1129401536 15:75287132-75287154 TGGGCTTGTGTTTCTGGAGGAGG + Intronic
1129475132 15:75779836-75779858 TGGGCTCGTGTTTCCGGAGAAGG + Intergenic
1129729607 15:77922547-77922569 TGGGCTCGTGTTTCCGGAGGAGG - Intergenic
1129838918 15:78731432-78731454 TGGGCTCATGTTTCTGGAGGAGG + Intergenic
1130484518 15:84391155-84391177 TAGGCTCGTGTTTCTGGAGGAGG + Intergenic
1132433465 15:101778719-101778741 TGGGCTTGTGTTTTGAGAGGAGG - Intergenic
1132500485 16:282667-282689 TGAGTTTGTGACTCCGGTGGAGG + Exonic
1132578426 16:674504-674526 TGGGCTTGTGTGACCAGATGTGG + Intronic
1132724905 16:1334296-1334318 TGGGCCGGGGTCTCCGGGGGAGG + Intronic
1139127923 16:64103728-64103750 TATGCTTGTGTCTACTGAGGTGG + Intergenic
1139193520 16:64892103-64892125 TGGGCTTCTTTCTCCAGAGGTGG + Intergenic
1140981512 16:80114048-80114070 TGGGCTTGTTACTCAGGAGATGG + Intergenic
1142010718 16:87712448-87712470 TGGGTTTCTGTCACCGGAGAGGG - Intronic
1142237915 16:88931376-88931398 TGTGCTTGTGTCTCTGGAAGGGG - Intronic
1142304748 16:89278926-89278948 TGGGGCTGTGTCTCCTCAGGTGG + Intronic
1142309888 16:89306274-89306296 GTGGCGTGTGTCTGCGGAGGGGG - Intronic
1142920704 17:3182795-3182817 AGGGCTTGGGTCTCAGGGGGTGG + Intergenic
1143171115 17:4931083-4931105 TGTGCTTGTGTCTCAGGAGAAGG + Intergenic
1143653460 17:8278843-8278865 TGTGCCTCTGTCTCCGCAGGAGG + Intergenic
1148793730 17:50187441-50187463 TGGGCTTGGGGCTCAGGAAGAGG + Intronic
1148966878 17:51443125-51443147 TGGGCTTCTGCCTCAGCAGGTGG + Intergenic
1149156288 17:53633400-53633422 TAGGTTTATGTCTCCTGAGGGGG + Intergenic
1149229652 17:54518676-54518698 AGGGCTTGTGCATCCTGAGGGGG + Intergenic
1150217005 17:63476681-63476703 CGGCCTTGTCACTCCGGAGGCGG + Intergenic
1150835958 17:68564681-68564703 TGGGCTTGGGCCTTAGGAGGTGG + Intronic
1157271753 18:46281688-46281710 TGGGCATGTGGGTCCGGTGGTGG + Intergenic
1162386153 19:10361726-10361748 TGGGGGTGTGTCTGTGGAGGAGG - Intronic
1162493279 19:11007883-11007905 TGGGCTTGTCTCTTGGTAGGAGG + Exonic
1163413888 19:17173879-17173901 GTGGCTTCTGTCTCCGGAAGGGG + Intronic
1163582299 19:18145941-18145963 TGGGGTTGTGTGTCTGGACGCGG - Intronic
1163633407 19:18428031-18428053 TGGGCCTGTGGCTGGGGAGGTGG + Intronic
1163729782 19:18942102-18942124 TGGGCTTGGGGCTGGGGAGGTGG - Intergenic
1165335484 19:35166905-35166927 TGGGCTTGTGACTGCTGGGGTGG - Intronic
1165746368 19:38232218-38232240 TAGGGTTGTGTCTGAGGAGGTGG - Intergenic
1166303239 19:41923763-41923785 TGGGGGTGTGTCTGGGGAGGTGG + Intronic
1166303329 19:41923997-41924019 TGGGGGTGTGTCTGGGGAGGTGG + Intronic
1166960837 19:46495053-46495075 TGGGCCTGCGTCTCCGAAGCGGG + Exonic
1168276181 19:55279939-55279961 CGGGCTTGTTGCTACGGAGGCGG - Intronic
1202710507 1_KI270714v1_random:17129-17151 TGTGGTTGTGTTTCAGGAGGAGG - Intergenic
928366162 2:30705248-30705270 TGTGCTTGTGTGTCCCTAGGAGG + Intergenic
929836707 2:45408465-45408487 TAAGCTTGTCTCTCAGGAGGAGG - Intronic
931798739 2:65737541-65737563 TGGGCTAGTGTCTCTGGGGCAGG - Intergenic
933612287 2:84449503-84449525 TGGGGTTGTATCTCAGGAGGAGG - Intronic
935174892 2:100641162-100641184 TGGGTTTATGACTCCAGAGGCGG - Intergenic
937366234 2:121264089-121264111 TAGGCTTGGGGCTCAGGAGGGGG + Intronic
937631099 2:124102007-124102029 TGGGCAAGTGTCTCTGGAGCTGG - Intronic
937682078 2:124654775-124654797 TAGGCGTGTGTCTGTGGAGGCGG - Intronic
939928323 2:148201326-148201348 TGGGCTCTGGTCTCCGGACGAGG + Intronic
942023825 2:171893907-171893929 TGGGATTGTGAGTCCGGAGTTGG - Intronic
946190044 2:218003205-218003227 AGGGGTTGTGTGTCCGGGGGTGG - Intergenic
946430937 2:219627285-219627307 GGGGCCTGTGTCTGCGGAGGGGG + Intergenic
948434776 2:237945595-237945617 TGGCCTTGTGTCTCAGGTCGGGG - Intergenic
948761346 2:240193537-240193559 AGGGCATGTGTCTCTGTAGGTGG + Intergenic
1173280002 20:41618868-41618890 GGGGCTGGCGTCTCCGGGGGTGG + Intergenic
1176089105 20:63311206-63311228 TGGCCTTGTGTCCCCAGAGCTGG + Intronic
1179719005 21:43305022-43305044 AGGGCTTGTGTGTTCGGTGGGGG + Intergenic
1181492246 22:23267894-23267916 TGGGCTTGTGTCTGTGCAGTGGG + Intronic
1182764331 22:32747796-32747818 TGGCCTTGTGTCTCCAGACTTGG + Intronic
1183654806 22:39178162-39178184 AGGGGTTGTGTCTGTGGAGGAGG + Intergenic
1183694922 22:39416169-39416191 TGGGCTTCTGTTCCCGGAGAGGG + Intronic
1185204331 22:49529022-49529044 TGGGCAGGTGAGTCCGGAGGGGG + Intronic
1185204365 22:49529157-49529179 TGGGCAGGTGAGTCCGGAGGGGG + Intronic
1185204379 22:49529202-49529224 TGGGCAGGTGAGTCCGGAGGGGG + Intronic
1185204415 22:49529337-49529359 TGGGCAGGTGAGTCCGGAGGGGG + Intronic
1185204442 22:49529427-49529449 TGGGCAGGTGAGTCCGGAGGGGG + Intronic
1185222632 22:49636626-49636648 GGGGCTTGTGTGTCCAGGGGAGG + Intronic
1185279362 22:49963385-49963407 TGTGCTGCTGTGTCCGGAGGCGG + Exonic
953716720 3:45322137-45322159 TGGGCTTGTTTCCCCTGAGCGGG - Intergenic
954561440 3:51560201-51560223 TGGGCTTGTGTTTGAGGAGGAGG + Intronic
954795188 3:53157793-53157815 TGGGCTTGTGTTTCTGGAGCAGG - Intronic
956662885 3:71616697-71616719 TGGGCCTGAGCCTCTGGAGGAGG - Intergenic
957164016 3:76647189-76647211 TGGGCTAGTGTCTCTGAGGGGGG + Intronic
957386603 3:79503451-79503473 TGTGCTTGTGTGTCCGGAATTGG - Intronic
968086637 3:195876845-195876867 GGGGCGTGTGTCTCTGGAGCTGG - Intronic
971279358 4:25229820-25229842 TGGAATTGTTTCTCCTGAGGAGG - Intronic
973391441 4:49560599-49560621 GGGGCTTGTGCCCCAGGAGGGGG - Intergenic
975319723 4:72996227-72996249 TGGTCTTGAGTCTCTGGGGGTGG - Intergenic
982758502 4:159252125-159252147 TGGAGTTGTGTCTCCGGAATTGG - Intronic
983449661 4:167894842-167894864 TGGGGTTGTGTGTTCGGGGGAGG - Intergenic
986393335 5:7304743-7304765 TGGGCTTCCGTTTCCTGAGGAGG - Intergenic
986720207 5:10555593-10555615 TGGGCATGAGTCACCGGTGGGGG + Intergenic
990861691 5:60334631-60334653 TGGGCTTGTGTCTCCTAAATAGG - Intronic
991054594 5:62306850-62306872 CGGGCTGGTGTCCCCGGGGGGGG - Intronic
991612949 5:68467352-68467374 TGGGTTTGTGTTTCTGGTGGTGG + Intergenic
998401583 5:141851433-141851455 AGGGCATGTCTCTCCGTAGGGGG - Intergenic
1002163632 5:177331842-177331864 GGGGCTGGTGTCTCAGGAGCAGG - Exonic
1002565711 5:180112173-180112195 TGGGCTGGTGTCACCTGCGGAGG + Intronic
1007238584 6:40409010-40409032 AGGGCTTGTGGCTACCGAGGGGG - Intronic
1018690906 6:166343044-166343066 GGTGTTTGTGTCTCCGGATGAGG - Intergenic
1020144872 7:5634632-5634654 TGGGCTTGTCTGACCTGAGGAGG - Intronic
1022277719 7:28872445-28872467 TGGGCTTCTGTTTCCTGATGTGG - Intergenic
1022906306 7:34861122-34861144 TGGGCTTTTGCCTCCGGCAGAGG - Intronic
1024586831 7:50849483-50849505 AGGGCTTGTGTTTCTGCAGGTGG - Intergenic
1024797555 7:53036581-53036603 TGGGCTTGTGTCTCCGGAGGTGG - Exonic
1026506376 7:70987991-70988013 TGGAGTTGTGTCTTAGGAGGAGG - Intergenic
1028987045 7:97017115-97017137 CTGGCCTGTGTCACCGGAGGGGG + Intergenic
1029115284 7:98233471-98233493 TGGGCCTGGGTGTCGGGAGGCGG - Exonic
1032470278 7:132173509-132173531 TGGGCTTTTCTATCTGGAGGAGG - Intronic
1032878381 7:136062574-136062596 TGGTCTTGTGTGGCTGGAGGAGG - Intergenic
1038883489 8:31639625-31639647 GGGGCTGCTGTCACCGGAGGAGG - Intronic
1040339845 8:46434978-46435000 GGTGCTTGTGTCTCTCGAGGAGG - Intergenic
1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG + Exonic
1049306551 8:141907129-141907151 TGGCCTTCAGTCTACGGAGGAGG - Intergenic
1049364345 8:142229561-142229583 TGATCTTGTGTCTCTGGAGCTGG + Exonic
1049672407 8:143875881-143875903 TGTGCGTGTGTCCCAGGAGGTGG + Intronic
1053276176 9:36785128-36785150 AGGGCTTGTGCCTTGGGAGGTGG + Intergenic
1057631121 9:96719876-96719898 TCGGCTTGTGCCTGGGGAGGAGG + Intergenic
1058897311 9:109411491-109411513 TGGGCCTGTGGCTCCGGAAGGGG - Intronic
1061064091 9:128266809-128266831 TGGGCTTGCATTTCCTGAGGAGG - Intronic
1203786019 EBV:128004-128026 GTGGCTTGGGGCTCCGGAGGTGG - Intergenic
1194785336 X:98077142-98077164 TGAGATTGTGTCTCTGCAGGAGG - Intergenic
1195667922 X:107447664-107447686 TGGGGTGGTGTCTCAGGAGGTGG - Intergenic
1202366829 Y:24171341-24171363 TAGGCTCGTGTTTCTGGAGGAGG + Intergenic
1202503953 Y:25498782-25498804 TAGGCTCGTGTTTCTGGAGGAGG - Intergenic