ID: 1024801686

View in Genome Browser
Species Human (GRCh38)
Location 7:53087148-53087170
Sequence AGGAGCCCCCAGGTCTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024801686_1024801694 12 Left 1024801686 7:53087148-53087170 CCAGGAAAGACCTGGGGGCTCCT No data
Right 1024801694 7:53087183-53087205 ATCTCCTGGGAAGAATACTTTGG No data
1024801686_1024801698 17 Left 1024801686 7:53087148-53087170 CCAGGAAAGACCTGGGGGCTCCT No data
Right 1024801698 7:53087188-53087210 CTGGGAAGAATACTTTGGAGGGG No data
1024801686_1024801691 -1 Left 1024801686 7:53087148-53087170 CCAGGAAAGACCTGGGGGCTCCT No data
Right 1024801691 7:53087170-53087192 TGGTGTCCCATATATCTCCTGGG No data
1024801686_1024801695 15 Left 1024801686 7:53087148-53087170 CCAGGAAAGACCTGGGGGCTCCT No data
Right 1024801695 7:53087186-53087208 TCCTGGGAAGAATACTTTGGAGG No data
1024801686_1024801697 16 Left 1024801686 7:53087148-53087170 CCAGGAAAGACCTGGGGGCTCCT No data
Right 1024801697 7:53087187-53087209 CCTGGGAAGAATACTTTGGAGGG No data
1024801686_1024801690 -2 Left 1024801686 7:53087148-53087170 CCAGGAAAGACCTGGGGGCTCCT No data
Right 1024801690 7:53087169-53087191 CTGGTGTCCCATATATCTCCTGG No data
1024801686_1024801699 21 Left 1024801686 7:53087148-53087170 CCAGGAAAGACCTGGGGGCTCCT No data
Right 1024801699 7:53087192-53087214 GAAGAATACTTTGGAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024801686 Original CRISPR AGGAGCCCCCAGGTCTTTCC TGG (reversed) Intergenic
No off target data available for this crispr