ID: 1024801689

View in Genome Browser
Species Human (GRCh38)
Location 7:53087168-53087190
Sequence CAGGAGATATATGGGACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024801689_1024801695 -5 Left 1024801689 7:53087168-53087190 CCTGGTGTCCCATATATCTCCTG No data
Right 1024801695 7:53087186-53087208 TCCTGGGAAGAATACTTTGGAGG No data
1024801689_1024801694 -8 Left 1024801689 7:53087168-53087190 CCTGGTGTCCCATATATCTCCTG No data
Right 1024801694 7:53087183-53087205 ATCTCCTGGGAAGAATACTTTGG No data
1024801689_1024801701 18 Left 1024801689 7:53087168-53087190 CCTGGTGTCCCATATATCTCCTG No data
Right 1024801701 7:53087209-53087231 GGCAGGTGACTTAAGGCAGACGG No data
1024801689_1024801699 1 Left 1024801689 7:53087168-53087190 CCTGGTGTCCCATATATCTCCTG No data
Right 1024801699 7:53087192-53087214 GAAGAATACTTTGGAGGGGCAGG No data
1024801689_1024801698 -3 Left 1024801689 7:53087168-53087190 CCTGGTGTCCCATATATCTCCTG No data
Right 1024801698 7:53087188-53087210 CTGGGAAGAATACTTTGGAGGGG No data
1024801689_1024801700 11 Left 1024801689 7:53087168-53087190 CCTGGTGTCCCATATATCTCCTG No data
Right 1024801700 7:53087202-53087224 TTGGAGGGGCAGGTGACTTAAGG No data
1024801689_1024801697 -4 Left 1024801689 7:53087168-53087190 CCTGGTGTCCCATATATCTCCTG No data
Right 1024801697 7:53087187-53087209 CCTGGGAAGAATACTTTGGAGGG No data
1024801689_1024801704 21 Left 1024801689 7:53087168-53087190 CCTGGTGTCCCATATATCTCCTG No data
Right 1024801704 7:53087212-53087234 AGGTGACTTAAGGCAGACGGGGG No data
1024801689_1024801703 20 Left 1024801689 7:53087168-53087190 CCTGGTGTCCCATATATCTCCTG No data
Right 1024801703 7:53087211-53087233 CAGGTGACTTAAGGCAGACGGGG No data
1024801689_1024801702 19 Left 1024801689 7:53087168-53087190 CCTGGTGTCCCATATATCTCCTG No data
Right 1024801702 7:53087210-53087232 GCAGGTGACTTAAGGCAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024801689 Original CRISPR CAGGAGATATATGGGACACC AGG (reversed) Intergenic