ID: 1024801690

View in Genome Browser
Species Human (GRCh38)
Location 7:53087169-53087191
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024801686_1024801690 -2 Left 1024801686 7:53087148-53087170 CCAGGAAAGACCTGGGGGCTCCT No data
Right 1024801690 7:53087169-53087191 CTGGTGTCCCATATATCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024801690 Original CRISPR CTGGTGTCCCATATATCTCC TGG Intergenic
No off target data available for this crispr