ID: 1024801692

View in Genome Browser
Species Human (GRCh38)
Location 7:53087176-53087198
Sequence ATTCTTCCCAGGAGATATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024801692_1024801701 10 Left 1024801692 7:53087176-53087198 CCCATATATCTCCTGGGAAGAAT No data
Right 1024801701 7:53087209-53087231 GGCAGGTGACTTAAGGCAGACGG No data
1024801692_1024801704 13 Left 1024801692 7:53087176-53087198 CCCATATATCTCCTGGGAAGAAT No data
Right 1024801704 7:53087212-53087234 AGGTGACTTAAGGCAGACGGGGG No data
1024801692_1024801702 11 Left 1024801692 7:53087176-53087198 CCCATATATCTCCTGGGAAGAAT No data
Right 1024801702 7:53087210-53087232 GCAGGTGACTTAAGGCAGACGGG No data
1024801692_1024801703 12 Left 1024801692 7:53087176-53087198 CCCATATATCTCCTGGGAAGAAT No data
Right 1024801703 7:53087211-53087233 CAGGTGACTTAAGGCAGACGGGG No data
1024801692_1024801700 3 Left 1024801692 7:53087176-53087198 CCCATATATCTCCTGGGAAGAAT No data
Right 1024801700 7:53087202-53087224 TTGGAGGGGCAGGTGACTTAAGG No data
1024801692_1024801699 -7 Left 1024801692 7:53087176-53087198 CCCATATATCTCCTGGGAAGAAT No data
Right 1024801699 7:53087192-53087214 GAAGAATACTTTGGAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024801692 Original CRISPR ATTCTTCCCAGGAGATATAT GGG (reversed) Intergenic