ID: 1024801694

View in Genome Browser
Species Human (GRCh38)
Location 7:53087183-53087205
Sequence ATCTCCTGGGAAGAATACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024801686_1024801694 12 Left 1024801686 7:53087148-53087170 CCAGGAAAGACCTGGGGGCTCCT No data
Right 1024801694 7:53087183-53087205 ATCTCCTGGGAAGAATACTTTGG No data
1024801688_1024801694 2 Left 1024801688 7:53087158-53087180 CCTGGGGGCTCCTGGTGTCCCAT No data
Right 1024801694 7:53087183-53087205 ATCTCCTGGGAAGAATACTTTGG No data
1024801689_1024801694 -8 Left 1024801689 7:53087168-53087190 CCTGGTGTCCCATATATCTCCTG No data
Right 1024801694 7:53087183-53087205 ATCTCCTGGGAAGAATACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024801694 Original CRISPR ATCTCCTGGGAAGAATACTT TGG Intergenic
No off target data available for this crispr