ID: 1024801695

View in Genome Browser
Species Human (GRCh38)
Location 7:53087186-53087208
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024801689_1024801695 -5 Left 1024801689 7:53087168-53087190 CCTGGTGTCCCATATATCTCCTG No data
Right 1024801695 7:53087186-53087208 TCCTGGGAAGAATACTTTGGAGG No data
1024801686_1024801695 15 Left 1024801686 7:53087148-53087170 CCAGGAAAGACCTGGGGGCTCCT No data
Right 1024801695 7:53087186-53087208 TCCTGGGAAGAATACTTTGGAGG No data
1024801688_1024801695 5 Left 1024801688 7:53087158-53087180 CCTGGGGGCTCCTGGTGTCCCAT No data
Right 1024801695 7:53087186-53087208 TCCTGGGAAGAATACTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024801695 Original CRISPR TCCTGGGAAGAATACTTTGG AGG Intergenic