ID: 1024801696

View in Genome Browser
Species Human (GRCh38)
Location 7:53087187-53087209
Sequence CCCTCCAAAGTATTCTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024801696_1024801706 24 Left 1024801696 7:53087187-53087209 CCTGGGAAGAATACTTTGGAGGG No data
Right 1024801706 7:53087234-53087256 GCATTGTCGACCCCCTATGGAGG No data
1024801696_1024801707 25 Left 1024801696 7:53087187-53087209 CCTGGGAAGAATACTTTGGAGGG No data
Right 1024801707 7:53087235-53087257 CATTGTCGACCCCCTATGGAGGG No data
1024801696_1024801703 1 Left 1024801696 7:53087187-53087209 CCTGGGAAGAATACTTTGGAGGG No data
Right 1024801703 7:53087211-53087233 CAGGTGACTTAAGGCAGACGGGG No data
1024801696_1024801700 -8 Left 1024801696 7:53087187-53087209 CCTGGGAAGAATACTTTGGAGGG No data
Right 1024801700 7:53087202-53087224 TTGGAGGGGCAGGTGACTTAAGG No data
1024801696_1024801701 -1 Left 1024801696 7:53087187-53087209 CCTGGGAAGAATACTTTGGAGGG No data
Right 1024801701 7:53087209-53087231 GGCAGGTGACTTAAGGCAGACGG No data
1024801696_1024801704 2 Left 1024801696 7:53087187-53087209 CCTGGGAAGAATACTTTGGAGGG No data
Right 1024801704 7:53087212-53087234 AGGTGACTTAAGGCAGACGGGGG No data
1024801696_1024801702 0 Left 1024801696 7:53087187-53087209 CCTGGGAAGAATACTTTGGAGGG No data
Right 1024801702 7:53087210-53087232 GCAGGTGACTTAAGGCAGACGGG No data
1024801696_1024801705 21 Left 1024801696 7:53087187-53087209 CCTGGGAAGAATACTTTGGAGGG No data
Right 1024801705 7:53087231-53087253 GGGGCATTGTCGACCCCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024801696 Original CRISPR CCCTCCAAAGTATTCTTCCC AGG (reversed) Intergenic