ID: 1024801703

View in Genome Browser
Species Human (GRCh38)
Location 7:53087211-53087233
Sequence CAGGTGACTTAAGGCAGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024801688_1024801703 30 Left 1024801688 7:53087158-53087180 CCTGGGGGCTCCTGGTGTCCCAT No data
Right 1024801703 7:53087211-53087233 CAGGTGACTTAAGGCAGACGGGG No data
1024801696_1024801703 1 Left 1024801696 7:53087187-53087209 CCTGGGAAGAATACTTTGGAGGG No data
Right 1024801703 7:53087211-53087233 CAGGTGACTTAAGGCAGACGGGG No data
1024801689_1024801703 20 Left 1024801689 7:53087168-53087190 CCTGGTGTCCCATATATCTCCTG No data
Right 1024801703 7:53087211-53087233 CAGGTGACTTAAGGCAGACGGGG No data
1024801692_1024801703 12 Left 1024801692 7:53087176-53087198 CCCATATATCTCCTGGGAAGAAT No data
Right 1024801703 7:53087211-53087233 CAGGTGACTTAAGGCAGACGGGG No data
1024801693_1024801703 11 Left 1024801693 7:53087177-53087199 CCATATATCTCCTGGGAAGAATA No data
Right 1024801703 7:53087211-53087233 CAGGTGACTTAAGGCAGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024801703 Original CRISPR CAGGTGACTTAAGGCAGACG GGG Intergenic
No off target data available for this crispr