ID: 1024802291

View in Genome Browser
Species Human (GRCh38)
Location 7:53094293-53094315
Sequence CTGCCTCTGTTTACTATATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024802291_1024802295 5 Left 1024802291 7:53094293-53094315 CCAGATATAGTAAACAGAGGCAG No data
Right 1024802295 7:53094321-53094343 AGTCCCGAGCATATGGTCAAGGG No data
1024802291_1024802296 6 Left 1024802291 7:53094293-53094315 CCAGATATAGTAAACAGAGGCAG No data
Right 1024802296 7:53094322-53094344 GTCCCGAGCATATGGTCAAGGGG No data
1024802291_1024802302 30 Left 1024802291 7:53094293-53094315 CCAGATATAGTAAACAGAGGCAG No data
Right 1024802302 7:53094346-53094368 CCCAGTTCTTTGTGAGGCTGTGG No data
1024802291_1024802299 24 Left 1024802291 7:53094293-53094315 CCAGATATAGTAAACAGAGGCAG No data
Right 1024802299 7:53094340-53094362 AGGGGCCCCAGTTCTTTGTGAGG No data
1024802291_1024802294 4 Left 1024802291 7:53094293-53094315 CCAGATATAGTAAACAGAGGCAG No data
Right 1024802294 7:53094320-53094342 TAGTCCCGAGCATATGGTCAAGG No data
1024802291_1024802293 -2 Left 1024802291 7:53094293-53094315 CCAGATATAGTAAACAGAGGCAG No data
Right 1024802293 7:53094314-53094336 AGGTTTTAGTCCCGAGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024802291 Original CRISPR CTGCCTCTGTTTACTATATC TGG (reversed) Intergenic
No off target data available for this crispr