ID: 1024803506 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:53108566-53108588 |
Sequence | CTGAGAGGGGGAAACGGATG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1024803500_1024803506 | 26 | Left | 1024803500 | 7:53108517-53108539 | CCTGTCATTGCTTCTGTTTTCTC | No data | ||
Right | 1024803506 | 7:53108566-53108588 | CTGAGAGGGGGAAACGGATGAGG | No data | ||||
1024803499_1024803506 | 29 | Left | 1024803499 | 7:53108514-53108536 | CCTCCTGTCATTGCTTCTGTTTT | No data | ||
Right | 1024803506 | 7:53108566-53108588 | CTGAGAGGGGGAAACGGATGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1024803506 | Original CRISPR | CTGAGAGGGGGAAACGGATG AGG | Intergenic | ||
No off target data available for this crispr |