ID: 1024803506

View in Genome Browser
Species Human (GRCh38)
Location 7:53108566-53108588
Sequence CTGAGAGGGGGAAACGGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024803500_1024803506 26 Left 1024803500 7:53108517-53108539 CCTGTCATTGCTTCTGTTTTCTC No data
Right 1024803506 7:53108566-53108588 CTGAGAGGGGGAAACGGATGAGG No data
1024803499_1024803506 29 Left 1024803499 7:53108514-53108536 CCTCCTGTCATTGCTTCTGTTTT No data
Right 1024803506 7:53108566-53108588 CTGAGAGGGGGAAACGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024803506 Original CRISPR CTGAGAGGGGGAAACGGATG AGG Intergenic
No off target data available for this crispr