ID: 1024809826

View in Genome Browser
Species Human (GRCh38)
Location 7:53195741-53195763
Sequence CCGGAGCCTGCACCTTCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024809826_1024809832 18 Left 1024809826 7:53195741-53195763 CCACTGGAAGGTGCAGGCTCCGG No data
Right 1024809832 7:53195782-53195804 CAGGACGAGTATGGAATCGATGG No data
1024809826_1024809830 -1 Left 1024809826 7:53195741-53195763 CCACTGGAAGGTGCAGGCTCCGG No data
Right 1024809830 7:53195763-53195785 GTTAATTGAGCTGAGATGGCAGG No data
1024809826_1024809828 -5 Left 1024809826 7:53195741-53195763 CCACTGGAAGGTGCAGGCTCCGG No data
Right 1024809828 7:53195759-53195781 TCCGGTTAATTGAGCTGAGATGG No data
1024809826_1024809831 9 Left 1024809826 7:53195741-53195763 CCACTGGAAGGTGCAGGCTCCGG No data
Right 1024809831 7:53195773-53195795 CTGAGATGGCAGGACGAGTATGG No data
1024809826_1024809833 25 Left 1024809826 7:53195741-53195763 CCACTGGAAGGTGCAGGCTCCGG No data
Right 1024809833 7:53195789-53195811 AGTATGGAATCGATGGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024809826 Original CRISPR CCGGAGCCTGCACCTTCCAG TGG (reversed) Intergenic
No off target data available for this crispr