ID: 1024812821

View in Genome Browser
Species Human (GRCh38)
Location 7:53234072-53234094
Sequence TGTCACTCCTTGGTCAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024812821_1024812823 0 Left 1024812821 7:53234072-53234094 CCAGTTTTGACCAAGGAGTGACA No data
Right 1024812823 7:53234095-53234117 AAGACTCTGCCTTTGTTACCTGG No data
1024812821_1024812825 9 Left 1024812821 7:53234072-53234094 CCAGTTTTGACCAAGGAGTGACA No data
Right 1024812825 7:53234104-53234126 CCTTTGTTACCTGGAAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024812821 Original CRISPR TGTCACTCCTTGGTCAAAAC TGG (reversed) Intergenic
No off target data available for this crispr