ID: 1024816352

View in Genome Browser
Species Human (GRCh38)
Location 7:53275951-53275973
Sequence CCAGCTTCTACACACCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024816347_1024816352 -5 Left 1024816347 7:53275933-53275955 CCAAATAGTCCCAGCTTCCCAGC No data
Right 1024816352 7:53275951-53275973 CCAGCTTCTACACACCATGCAGG No data
1024816346_1024816352 18 Left 1024816346 7:53275910-53275932 CCGAGATATCATTCTTCTGTTTA No data
Right 1024816352 7:53275951-53275973 CCAGCTTCTACACACCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024816352 Original CRISPR CCAGCTTCTACACACCATGC AGG Intergenic
No off target data available for this crispr