ID: 1024819101

View in Genome Browser
Species Human (GRCh38)
Location 7:53306055-53306077
Sequence GTGAACCCTCGGAGGACTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024819095_1024819101 11 Left 1024819095 7:53306021-53306043 CCTGTTACTCTGCCTTTTGTGAG No data
Right 1024819101 7:53306055-53306077 GTGAACCCTCGGAGGACTAAGGG No data
1024819096_1024819101 -1 Left 1024819096 7:53306033-53306055 CCTTTTGTGAGTTGATTTTCCAG 0: 7
1: 42
2: 131
3: 175
4: 443
Right 1024819101 7:53306055-53306077 GTGAACCCTCGGAGGACTAAGGG No data
1024819094_1024819101 19 Left 1024819094 7:53306013-53306035 CCATTTCTCCTGTTACTCTGCCT No data
Right 1024819101 7:53306055-53306077 GTGAACCCTCGGAGGACTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024819101 Original CRISPR GTGAACCCTCGGAGGACTAA GGG Intergenic
No off target data available for this crispr