ID: 1024822689

View in Genome Browser
Species Human (GRCh38)
Location 7:53351941-53351963
Sequence CCTTGATATTTAAGAGTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024822689_1024822694 8 Left 1024822689 7:53351941-53351963 CCATTAACTCTTAAATATCAAGG No data
Right 1024822694 7:53351972-53351994 AGCTTTAATAGATGGGACACGGG No data
1024822689_1024822691 0 Left 1024822689 7:53351941-53351963 CCATTAACTCTTAAATATCAAGG No data
Right 1024822691 7:53351964-53351986 ACAACTGAAGCTTTAATAGATGG No data
1024822689_1024822692 1 Left 1024822689 7:53351941-53351963 CCATTAACTCTTAAATATCAAGG No data
Right 1024822692 7:53351965-53351987 CAACTGAAGCTTTAATAGATGGG No data
1024822689_1024822693 7 Left 1024822689 7:53351941-53351963 CCATTAACTCTTAAATATCAAGG No data
Right 1024822693 7:53351971-53351993 AAGCTTTAATAGATGGGACACGG No data
1024822689_1024822695 26 Left 1024822689 7:53351941-53351963 CCATTAACTCTTAAATATCAAGG No data
Right 1024822695 7:53351990-53352012 ACGGGACAGAACTACCTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024822689 Original CRISPR CCTTGATATTTAAGAGTTAA TGG (reversed) Intergenic
No off target data available for this crispr